Marqueurs

 
No Marker Name Marker R6 Position R6 Size bp Unit bp R6 No Repeats Locus Primer_f Primer_r
M_1 ms15_507bp_45bp_7U 1579 507 45 7 BOX TCCAACACGACCTTTATCCA AGCCTTGCTCCTCATCTTGA
M_2 ms17_167bp_45bp_3U 1783 167 45 3 BOX TCGAAAATCTCTGCAAACCA CGGACTAGGCGGCTGATTA
M_3 ms19_663pb_60pb_10U 1925 663 60 10 pcpA TCGGGTGTAGTCGTGTTTACT AACTGATGTAGCTAAACCTAAAAAGAA
M_4 ms25_426bp_45bp_4U 101 423 45 4 BOX TCGCCTTTGCTAATCAAACA GACTGGGTAACAATTCCATT
M_5 ms26_492bp_51bp_6U 185 492 51 6 Intergenic ATGGAACAGAAGGCGAATTG AACAAGGCCAGGATTTTCGT
M_6 ms27_326bp_45bp_3U 257 347 45 3 BOX TCAGGAACAGCTATTATCCC CCAACCTCCTTTTCGTTTCA
M_7 ms31_594bp_45bp_9U 557 594 45 9 BOX CTGGAATAGTCCATCGAGCTT CGAAGGTAAATGTGAACAAAC
M_8 ms32_280pb_45bp_2U 571 280 45 2 BOX AAAGCAAAATAATGCGCTCCT ACTACCAAAGCCCAAGTGGT
M_9 ms33_407bp_45bp_2U 698 407 45 2 BOX CAGCTGAACATGATGGCAAA CATCACTTCTCCCTTCTAATC
M_10 ms34_239bp_45bp_1U 1082 239 45 1 BOX CTCGGTAAAGACGAGGTTCAA CATCGTGCAGGGATTTTCTAA
M_11 ms35b_349bp_49bp_4U 1166 349 49 4 Intergenic ACAATCTCAGCTACGCCCTA ACGGGATGACATTAAAAACC
M_12 ms36b_319_274pb_45pb_2U 1209 319 45 2 trzA GAAATCTTGATCACAAGTCAC AAAAAGTTGCCTTCGAGTGAC
M_13 ms37_501bp_45bp_7U 1350 501 45 7 BOX ATGCGCAAATCGATTAAGGA CGATGTGCTTCACTCACTCC
M_14 ms38_309bp_45bp_2U 1911 297 45 1.5b BOX TCAGGAGTAGGTTCCTGACCA AACCCGAGAAGAAGTGCAAG
M_15 ms39_275bp_45bp_2U 1915 275 45 2 BOX CCTTGGACTACCACCTCGTT GCCGTGACAGACTTCTGGAA
M_16 ms40_376bp_45bp_3U 1611 376 45 3 BOX AGTAGTCTGCAATCGCAGCT GGGCCTTAAGTCGCTTTGAT
M_17 ms41_166pb_14pb_2U 394 166 14 2 Intergenic ACCGTAATGGGACTTCATCT ATCTGCACCTAAGACAATCG

Reference strain : R6

1- No is the no of the marker used in this table.
2- Name_Marker
It contains all the numbers necessary to characterize the marker in reference to a given sequenced genome (reference strain).
For example, in "ms15_507bp_45bp_7U", - ms means minisatellite, - 507 bp is the size of the amplification product of this marker; - 45 bp is the size of the repeat unit, - 7 is the number of repeats,
3- Position: position of the marker on the chromosome of the reference strain, expressed in kbp.
4- Size_bp: size of the amplicon of the reference strain.
5- Unit_bp is the size of one repeat unit.
6- No_Repeats is the number of repeat units (VNTRs) in the reference strain for the corresponding marker.
7- Locus is a brief description of the locus where the repeat sequence was identified (gene or intergenic).
8- Primer_f is the forward primer designed from the left flanking sequence of the repeats.
9- Primer_r is the reverse primer designed from the right flanking sequence of the repeats.

Retour accueil ]